(FUNCTIONAL GENOMIC ANALYSIS FOR THE ENHANCEMENT OF SUCROSE CONTENT IN SUGARCANE (SACCHARUM SPP
SHEREEN KHALED MOHAMED KHALED;
Abstract
This study was carried out in the Laboratories of the Department of Genetics, Faculty of Agriculture, Ain shams University, Shoubra Elkheima, Egypt and Sugar Crops Research Institute (SCRI), Agriculture Research Center (ARC) in Giza, Egypt during the period from 2011 to 2018. The aim of the study is to down- regulate soluble acid invertase (SAI)in Egyptian cultivated varieties using siRNA silencing approaches and study the down regulation impact on sucrose content.
Two Egyptian sugarcane, G.T.45-9genotypesand G.99/103 variety, were hijacked using Agrobacteriumtumeficiensstrain LB4404 harboring the expression vector (pFGC5941) which was triggered with the designed shRNA to terminate soluble acid invertase action in sugarcane. The transformation process wasapplied at two different levels, Tissue culture-based Agrobacterium-mediated transformation (TCBAT) and in-planta transformation techniques. The genetically modified plants (GMO)wereevaluated to determine the efficacy of designed siRNA molecule. After selection, the transgenic plants weresubmitted to chemical and genetic analysis to estimate the silencing levels. Chemical evaluation was appliedusing invertase activity assay and genetically by comparative quantitation using QRT-PCR analysis. Finally, the BRIX concentrationwas used as the indicator for sucrose at seven and eight month of plant age.
The main findings of this study were as the following:
1. Using NCBI database, different soluble acid invertasesequences isolated from different sugarcane plants were realized. Designing shRNA from SAI1 gene with accession number (JQ406875.1) was submitted and confirmed by five steps using PSSRNAit web site.
2. According to the results of subsequent analysis, the siRNA targeting bases from 2161 to 2181 [siRNA1:5’UUGUUGAAGAGGAACACGCCG3’ with
Two Egyptian sugarcane, G.T.45-9genotypesand G.99/103 variety, were hijacked using Agrobacteriumtumeficiensstrain LB4404 harboring the expression vector (pFGC5941) which was triggered with the designed shRNA to terminate soluble acid invertase action in sugarcane. The transformation process wasapplied at two different levels, Tissue culture-based Agrobacterium-mediated transformation (TCBAT) and in-planta transformation techniques. The genetically modified plants (GMO)wereevaluated to determine the efficacy of designed siRNA molecule. After selection, the transgenic plants weresubmitted to chemical and genetic analysis to estimate the silencing levels. Chemical evaluation was appliedusing invertase activity assay and genetically by comparative quantitation using QRT-PCR analysis. Finally, the BRIX concentrationwas used as the indicator for sucrose at seven and eight month of plant age.
The main findings of this study were as the following:
1. Using NCBI database, different soluble acid invertasesequences isolated from different sugarcane plants were realized. Designing shRNA from SAI1 gene with accession number (JQ406875.1) was submitted and confirmed by five steps using PSSRNAit web site.
2. According to the results of subsequent analysis, the siRNA targeting bases from 2161 to 2181 [siRNA1:5’UUGUUGAAGAGGAACACGCCG3’ with
Other data
| Title | (FUNCTIONAL GENOMIC ANALYSIS FOR THE ENHANCEMENT OF SUCROSE CONTENT IN SUGARCANE (SACCHARUM SPP | Other Titles | تحليلات جينومية وظيفية لتحسين محتوى السكروز فى قصب السكر | Authors | SHEREEN KHALED MOHAMED KHALED | Issue Date | 2018 |
Recommend this item
Similar Items from Core Recommender Database
Items in Ain Shams Scholar are protected by copyright, with all rights reserved, unless otherwise indicated.