IL-6-174G/C Polymorphism in Obese Adolescents with Non -alcoholic Fatty Liver Disease and its Relation to Clinical Parameters

Abstract

Background: NAFLD is an emerging clinical problem among obese patients of all ages. NAFLD includes a broad spectrum of liver tissue alterations, ranging from pure steatosis to non-alcoholic steatohepatitis (NASH) to cirrhosis. Ultrasonography (US) is a cheap, non invasive and dependable technique to diagnose NAFLD and to measure the visceral fat commonly used in an ambulatory care setting Visceral adiposity increased in parallel with the steatosis degree. It has been suggested that genetic factors also predispose to NAFLD and that these might explain the difference in NAFLD progression between individuals. Polymorphisms of genes involved in inflammation/fibrosis, insulin sensitivity, and lipid metabolism might influence both the mechanism and extent of hepatic steatosis and its progression to NASH and cirrhosis . Several studies found a significant prevalence of IL-6 174C in NASH which likely contributed to the better understanding of the genetic susceptibility to the development of NAFLD and to its progression to NASH. Previous studies have shown the C allele of the IL-6_174G_C promoter polymorphism to be associated with prospective coronary heart disease risk and hypertension.. With respect to diabetes type 2 risk, an interaction between this polymorphism and BMI has been recently described It was reported that homozygosity for the – 174C allele was associated with indices of overweight. Objective: To study the prevalence of interleukin-6-174 G/C polymorphism in obese adolescents with NAFLD and to assess clinical parameters of NAFLD in obese adolescents between different genotypes of IL-6-174G/C polymorphism .Also was aiming to determine the visceral adiposity thickness cut off points as a risk factor to develop NAFLD in obese adolescents. Subjects and Methods: This is a cross-sectional case control study .It included 70 obese adolescents (BMI ≥95th percentile) recruited from ultrasonography clinic in the national research center. They were 48 females and 22 males. They were included according to the inclusion criteria (BMI ≥95th percentile, aged from15 to 18 years (late adolescents)), with non alcoholic fatty liver disease (NAFLD) diagnosed by ultrasonography),Cases were subjected to full medical history, thorough clinical examination, growth assessment and body composition determination, Serum transaminases, lipid profiles, fasting insulin and glucose, CRP, HOMA-IR ((Homeostasis Model Assessment) = (fasting insulin (IU/ ml) * fasting glucose)) were assessed. Abdominal ultrasonography was performed for all cases. Genetic study was done where the region of interest was amplified by PCR using oligonucleotides 5_TGACTTCAGCTTTACTCTTTGT3_ and 5_CTGATTGGAAACCTATTAAG3_for all the cases. The study also included seventy healthy adolescents as a control group. Results: Obese adolescents had significant higher anthropometric measures ((waist and hip circumferences),(triceps, abdominal, subscapular and biceps skin folds),BMI and waist/hip ratio ), visceral, subcutaneous fat thickness, lipid profile and transaminases level than normal subjects. The study showed that CC and GC genotypes are more prevalent in patient group as compared to GG genotypes where the prevalence of CC genotypes was85.2% in patients versus 14.8% in the control group and prevalence of GC genotypes was 53.1% in patients versus 49.1% in the control group and prevalence of GG genotype was 32.9% in patients versus 67.1% in the control group , whereas C allele is more prevalent in the patient group as compared to G allele where the prevalence of C allele was 67% in the patient group versus 33% in the control group and the prevalence of G allele was 40.1% in the patient group versus 59.9% in the control group. According to different genotypes aspartate transaminases alanine transaminases, high-density lipoprotein, triceps and subscapular skin folds showed significant difference. None of the other parameters is statistically significant. where patients with CC genotypes have higher triceps skin fold thickness, higher alanine transaminases level and lower HDL than GC and GG genotypes. Patients with grouped CC+ GC genotypes have significant higher serum insulin (25.50±11.267), HOMAIR( 6.0130±2.89774) and lower HDL(43.35±15.940) than patients with GG genotypes(18.70±12.417, 4.442±63.48922,53.33±22.906). Patients with C allele have significantly higher serum insulin (23.54±11.574), HOMA-IR (5.4976±2.89595) than the control subjects (18.45±12.657, 4.4358±3.20189). Significant difference was found in BMI (kg/m2), hip circumference, waist circumference, abdominal skin fold thickness, fat mass, visceral fat thickness , serum cholesterol and blood glucose according to the different sonographic grades of the non-alcoholic fatty liver disease among patients. Where patients with grade 3 NAFLD had significant higher values than patients with grade 2 NAFLD and 3 NAFLD. Patients with grade 2 NAFLD had significant higher fat mass, abdominal skin fold thickness, waist and hip circumferences, and BMI than grade 1 NAFLD. Positive correlation was found between alanine transferase and visceral fat thicknesses (r=, 0.311, p=0.001), waist circumference(r=0.244,p=0.042), abdominal skin fold thickness (r=.397,p=0.001)) By applying the ROC curve Cut-off points of visceral fat thickness for development of non alcoholic fatty liver disease in male patients is 3.9 cm and female patients is 3.55 cm Conclusion: IL-6 −174C variant is more prevalent in NAFLD than in healthy subjects and can be used as a predictor of NAFLD and possible progression of the disease to steatohepatitis and hepatocellular carcinoma, Measurements of liver enzymes alone are insufficient, and liver ultrasonography is required for early identification of NAFLD. The expansion of visceral fat was associated with the severity of nonalcoholic fatty liver disease in obese adolescents. Visceral fat thickness above 3.55 cm for obese adolescents female patients and above 3.9 cm for obese adolescents male patients can be predictive of NAFLD.